View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10108_low_25 (Length: 242)
Name: NF10108_low_25
Description: NF10108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10108_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 7 - 163
Target Start/End: Complemental strand, 39234386 - 39234229
Alignment:
| Q |
7 |
tttgatgagtcgaaaaaatcagcccaatgc-atagctcatggacaaaaatgtctatgcggcaatgcaaaaaagtacatatagtgtagtgtgattgatgca |
105 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39234386 |
tttgatgagttgaaaaaatcagcccaatgccatagctcatggacaaaaatgtctatgcggcaatgcaaaaaagtacatatagtgtagtgtgattgatgca |
39234287 |
T |
 |
| Q |
106 |
gctttttacaaaggaaagttttataatatataccatagaaacgatatttaaacaacca |
163 |
Q |
| |
|
|||||| ||||||||| ||||||||| |||| | ||||||||||||| |||||||| |
|
|
| T |
39234286 |
actttttgcaaaggaaaattttataatttataatagagaaacgatatttgaacaacca |
39234229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University