View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10108_low_28 (Length: 239)
Name: NF10108_low_28
Description: NF10108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10108_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 9568546 - 9568780
Alignment:
| Q |
1 |
tagcagatgaaggagaatcaaaagctatgacatcattggctacttgagaagattccaaggtacagaattgcttctc------------ccagttgcttgt |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9568546 |
tagcagatgaaggagaatcaaaagctatgacatcattggctacttgagaagattccaaggtacagaattgcttctcccagttgctctcccagttgcttgt |
9568645 |
T |
 |
| Q |
89 |
ttccaaagaaacattggttctttgccttctaccaccattatttgaattggtttgcaacgttttgaaacgattcttgtttgaatcaatctgtctcaaagac |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9568646 |
ttccaaagaaacattggttctttgccttctaccaccattattggaattggtttgcaacgttttgaaacgattcttgtttgaatcaatctgtctcaaagac |
9568745 |
T |
 |
| Q |
189 |
tgttgctggtagtataattgtataccggctgaatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
9568746 |
tgttgctggtagtataattgtataccggctgaatt |
9568780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University