View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10109_high_1 (Length: 371)
Name: NF10109_high_1
Description: NF10109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10109_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 13 - 353
Target Start/End: Original strand, 31827958 - 31828303
Alignment:
| Q |
13 |
gagacaatatctcatttattttttgaatgcgcatttttctctaaaatcttgactagtgttgttaactcgttgggtgtgtcagtagtgtatcacaatatca |
112 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31827958 |
gagacaatatctcgtttattttttgaatgcgcatttttctctaaaatcttgactagtgttgctaactggttgggtgtgtcagtagtgtatcacaatatca |
31828057 |
T |
 |
| Q |
113 |
gcagtgttcatttaaattcttttgttggattaatgcgcggaaataaagggattgaattgggattacgaataatattgttta-----ttatggagcatttg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
31828058 |
gcagtgttcatttaaattcttttgttggattaatgcgcggaaataaagggattgaattgggattacgaacaatatcgtttacttgcttatggagcatttg |
31828157 |
T |
 |
| Q |
208 |
gaaggcgagaaacgctnnnnnnnntcaggacaaaaaggtctcaactgataagattgtagatcaagtcggattactctcttggaactggttaacaaaatcc |
307 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31828158 |
gaaggcgagaaacgctaaaaaaattcaggacaaaaaggtctcgactgataagattgtagatcaagtcagattactctcttggaactggttaacaaaatcc |
31828257 |
T |
 |
| Q |
308 |
acaatcttcaaatatgaactggatcagtggtggtcgtgtcctcttg |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31828258 |
acaatcttcaaatatgaactggatcagtggtggtcgtgtcctcttg |
31828303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University