View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10109_high_2 (Length: 314)
Name: NF10109_high_2
Description: NF10109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10109_high_2 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 7 - 314
Target Start/End: Complemental strand, 30621829 - 30621522
Alignment:
| Q |
7 |
caggcaggatttagctatggaacagtggcatacatgtgcttcatgttttcagtaacaaccccaatggggataattttagggatgatattattctcattga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30621829 |
caggcaggatttagctatggaacagtggcatacatgtgcttcatgttttcagtaacaaccccaatggggataattttagggatgatattattctcattga |
30621730 |
T |
|
| Q |
107 |
ctggttatgatgatagtaaccctaatgccttaataattgaagggttactaggttcaatttcttcaggaattctaatttatatggcacttgttgatcttat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
30621729 |
ctggttatgatgatagtaaccctaatgccttaataattgaagggttactaggttcaatttcttcaggaattctaatttatatggcacttgttgatctcat |
30621630 |
T |
|
| Q |
207 |
agcagctgatttctttcacaacaagcttatgaattctgatccacgtttgaaaaaggcttcttttgttgcattaactatgggttctgcttctatgtctatt |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30621629 |
agcagctgatttctttcacaacaagcttatgaattctgatccacgtttgaaaaaggcttcttttgttgcattaactatgggttctgcttctatgtctatt |
30621530 |
T |
|
| Q |
307 |
cttgccct |
314 |
Q |
| |
|
|||||||| |
|
|
| T |
30621529 |
cttgccct |
30621522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University