View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10109_high_7 (Length: 239)
Name: NF10109_high_7
Description: NF10109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10109_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 141
Target Start/End: Complemental strand, 41932240 - 41932100
Alignment:
| Q |
1 |
aaattcatatattaaaattattaaacaataggagtgtatttaaatgtgtgaaaggctctggatgttcactttataattcttgaacatatcaaaattcgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41932240 |
aaattcatatattaaaattattaaacaataggagtgtatttaaatgtgtgaaaggctctggatgttcactttataattcttgaacatatcaaaattcgta |
41932141 |
T |
|
| Q |
101 |
atacaatttcaaatgtctctttagaagtaataaattttggt |
141 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
41932140 |
atacaacttcaaatgtctctttaaaagtaataaattttggt |
41932100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University