View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10109_high_8 (Length: 237)

Name: NF10109_high_8
Description: NF10109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10109_high_8
NF10109_high_8
[»] chr3 (1 HSPs)
chr3 (1-225)||(34980165-34980383)


Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 34980383 - 34980165
Alignment:
1 tataatcaatattgaagctaaaaatattatattgtatgcataatggctgttcgatttaactgnnnnnnntatacagcttatagggacgggaccagtaata 100  Q
    |||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||       ||||||||| |||     |||||||||||||    
34980383 tataatcaatattgaagctaaaaatattatattgcatgcatgatggctgttcgatttaactgaaaaaaatatacagctcata-----gggaccagtaata 34980289  T
101 cgatttgctttctatgtacagcggaaatggtcactccaaaaaatagttgatatatatcccattgatggaattaatcgtagcttattgcttaagacgattt 200  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34980288 cgatttgctttctatgtacagcggaaatggccactccaaaaaatagttgatatatatcccattgatggaattaatcgtagcttattgcttaagacgattt 34980189  T
201 gaaaattaaagcaaagtaaaaagtg 225  Q
    |||||||||||| ||||||||||||    
34980188 gaaaattaaagc-aagtaaaaagtg 34980165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University