View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10109_low_12 (Length: 299)
Name: NF10109_low_12
Description: NF10109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10109_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 21 - 294
Target Start/End: Complemental strand, 28940335 - 28940061
Alignment:
| Q |
21 |
actgagatcacagaccaactctgccatatagaaattcttatgtgcttttccagctaaatttgtttctcatatatgacacactcactgaattccaaaacac |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28940335 |
actgagatcacagaccaactctgccatatagaaattcttatgtgcttttccagctaaatttgtttctcatatatgacacactcactgaattccaaaacac |
28940236 |
T |
 |
| Q |
121 |
attagactcatatttaagctacatagtgccaacaaaacacacaccatcatattctctgaaacttgcatgagaaaccatcttttcaagatacttacatctc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28940235 |
attagactcatatttaagctacatagtgccaacaaaacacacaccatcatattctctgaaacttgcatgagaaaccatcttttcaagatacttacatctc |
28940136 |
T |
 |
| Q |
221 |
tctcagttagtttaccccatacccttttgg-ttttacctcaaaagtttgttcttatccaaatagtctctgcttct |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
28940135 |
tctcagttagtttaccccatacccttttggtttttacctcaaaagtttgttcttatccaaatagtgtttgcttct |
28940061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University