View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10109_low_16 (Length: 257)
Name: NF10109_low_16
Description: NF10109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10109_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 13 - 227
Target Start/End: Original strand, 31775175 - 31775392
Alignment:
| Q |
13 |
aagcaaaggtttgaagaaagtagctacaagctttcatacaaatgaaattgtgcaagaaatgataaatatggcatgagtctta---gaaggaagagaagta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31775175 |
aagcaaaggtttgaagaaagtagctacaagcttttatacaaatgaaattgtgcaagaaatgacaaatatggcatgagtcttattagaaggaagagaagta |
31775274 |
T |
 |
| Q |
110 |
caacctcttcttatactaagcaaactaaactaaaagggcttgttgtaacgaaacacaataaaaaccctaacattgttgttgaggagtataaatgtgccct |
209 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31775275 |
caacctcttcttatactaaacaaactaaactaaaagggcttcttgtaacgaaacacaataaaaaccctaacattgttgttgaggagtataaatgtgccct |
31775374 |
T |
 |
| Q |
210 |
tacctcatgttttatgta |
227 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
31775375 |
tacctcatgttttatgta |
31775392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University