View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10109_low_18 (Length: 249)
Name: NF10109_low_18
Description: NF10109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10109_low_18 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 249
Target Start/End: Complemental strand, 26456265 - 26456035
Alignment:
| Q |
19 |
gagctgaaccaaatgaaaatctccactcaaaggttgagagcccaaataagaatgttgttggatgcttaagttgggaacaccatgaaaacaaagtcagata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26456265 |
gagctgaaccaaatgaaaatctccactcaaaggttgagagcccaaataagaatgttgttggatgcttaagttgggaacaccatgaaaacaaagtcagata |
26456166 |
T |
|
| Q |
119 |
ccgaggtcgaagatttagaagaaaatatggtgcnnnnnnnggtttatactgttattgataagtgtgaaaaaacgaagggagttttagagcttgaggaagn |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26456165 |
ccgaggtcgaagatttagaagaaaatatggtgcaaaaaaaggtttatactgttattgataagtgtgaaaaaacgaagggagttttagagcttgaggaaga |
26456066 |
T |
|
| Q |
219 |
nnnnnntttggagcgtttgtttgcagtcacc |
249 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
26456065 |
aaaaaatttggagcgtttgtttgcagtcacc |
26456035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 113
Target Start/End: Complemental strand, 26455910 - 26455816
Alignment:
| Q |
19 |
gagctgaaccaaatgaaaatctccactcaaaggttgagagcccaaataagaatgttgttggatgcttaagttgggaacaccatgaaaacaaagtc |
113 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||| |||||||| |||| ||||||||| || |||||||||||||| |||||||| |
|
|
| T |
26455910 |
gagctcaaccaaatgaaaatctcccctcaaaggttgagagccctaataagaaagttggtggatgcttcagctgggaacaccatgatgacaaagtc |
26455816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 106 - 145
Target Start/End: Complemental strand, 26455414 - 26455375
Alignment:
| Q |
106 |
acaaagtcagataccgaggtcgaagatttagaagaaaata |
145 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26455414 |
acaaagtcagataccgaggtccgagatttagaagaaaata |
26455375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University