View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10109_low_19 (Length: 249)
Name: NF10109_low_19
Description: NF10109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10109_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 25617468 - 25617690
Alignment:
| Q |
18 |
ctataaaatcaccatcactgtcaaattttagttatgatttgtgcccacaaagaggtttattagatcaaaacatttttcattacctttcacgctttaactg |
117 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25617468 |
ctataaaatcaccatcactgtcacattttagttatgatttgtgcccacaaagaggtttattagatcaaaacatttttcatcacctttcacgctttaactg |
25617567 |
T |
 |
| Q |
118 |
gcttgaaattcaccttgagctagagagtcagttctactactataagtgtcttcttctgttatattgttcgttttctttattattattttgtcttgttcaa |
217 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25617568 |
gcttgaaattcagcttgagcaagagagtcagttctactactataagtgtcttcttctgttatattgttcgttttctttattattattttgtcttgttcaa |
25617667 |
T |
 |
| Q |
218 |
ttttatctttggcctccctttgc |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
25617668 |
ttttatctttggcctccctttgc |
25617690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University