View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10109_low_20 (Length: 247)
Name: NF10109_low_20
Description: NF10109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10109_low_20 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 6 - 247
Target Start/End: Complemental strand, 34980668 - 34980427
Alignment:
| Q |
6 |
gagatgaataccggtctcctgagggtgtttggagagcttcttctgatttggtttcttgggtacattattgctgtacatgtgaatggaaaactttgggaca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34980668 |
gagatgaataccggtctcctgagggtgtttggagagcttcttctgatttggtttcttgggtacattattgctgtacatgtgaatggaaaactttgggaca |
34980569 |
T |
 |
| Q |
106 |
gatagaaaagagctcttgtggtggggcccgatcacttgaataggacctaaagaacccaattactgactacaccaataacgaggtataagtgttcgaattt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34980568 |
gatagaaaagagctcttgtggtggggcccgatcacttgaataggacctaaagaacccaattagtgactacaccaataacgaggtataagtgttcgaattt |
34980469 |
T |
 |
| Q |
206 |
ttgaccatcatcaaataatgcggaccacatctatacattaca |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34980468 |
ttgaccatcatcaaataatgcggaccacatctatacattaca |
34980427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University