View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10109_low_31 (Length: 226)
Name: NF10109_low_31
Description: NF10109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10109_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 173
Target Start/End: Original strand, 31929340 - 31929512
Alignment:
| Q |
1 |
acaatcttgttatgttttgataaaggtagttaaaatcacgagttaactcgtaggatcgtatgtttaggtatcaattttgagttgactcgactataaagtc |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
31929340 |
acaatcttgttatgttttgataaaggttgttaaaatcacgagttaactcgtaggatcgtatgtttaggtatcaattttgagttgactcgactataaactc |
31929439 |
T |
 |
| Q |
101 |
caattaagttaactcgaaaatgaaaacatgtttattgggctggaatcgtagtgaatttgttaactcttaaact |
173 |
Q |
| |
|
|||||||||||||| |||||||||| || | ||| | || |||| |||||||||||||||||||||||||||| |
|
|
| T |
31929440 |
caattaagttaacttgaaaatgaaaccaagcttactcggatggactcgtagtgaatttgttaactcttaaact |
31929512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University