View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10109_low_7 (Length: 343)

Name: NF10109_low_7
Description: NF10109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10109_low_7
NF10109_low_7
[»] chr2 (1 HSPs)
chr2 (1-35)||(16737521-16737555)


Alignment Details
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 16737555 - 16737521
Alignment:
1 tgatcactttctatggctctctctttttgctacac 35  Q
    |||||||||||||||||||||||||||||||||||    
16737555 tgatcactttctatggctctctctttttgctacac 16737521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University