View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_1D_high_11 (Length: 298)
Name: NF10110_1D_high_11
Description: NF10110_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10110_1D_high_11 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 23 - 298
Target Start/End: Original strand, 26608241 - 26608518
Alignment:
| Q |
23 |
gatggcacgaccaacggaaggctgtgaggcaagacgacacagctagttgggtgaaaaaac--gggttgtgtttcaattagtcaatgatgcgcaagattgc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26608241 |
gatggcacgaccaacggaaggctgtgaggcaagacgacacagctagttgggtgaaaaaacaggggttgtgtttcaattagtcaatgatgcgcaagattgc |
26608340 |
T |
 |
| Q |
121 |
attgcaggacgaagtggcgaaacagtgctgcagaagggagcgtcaagatggcgtggtgagacggaagatcaaaataggttccaagttcacgagtaggatt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26608341 |
attgcaggacgaagtggcgaaacagtgcagcagaagggagcgtcaagatggcgtggtgagacggaagatcaaaataggttccaagttcacgagtaggatt |
26608440 |
T |
 |
| Q |
221 |
gtgtttcaatcaatctgnnnnnnnattaaattnnnnnnntagtcatctttaaagttttaatcttgtctattaaaaagt |
298 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26608441 |
gtgtttcaatcaatctgtttttttattaaattaaaaaaatagtcatctttaaagttttaatcttgtctattaaaaagt |
26608518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University