View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_1D_high_14 (Length: 250)
Name: NF10110_1D_high_14
Description: NF10110_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10110_1D_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 32259237 - 32259480
Alignment:
Q |
1 |
ggtttgatattgatctatcaagggaggagaccttacgaggcaacggaaatgtctcactttcatttaattcccagggggtgttgaaaatttgtgtaaaaaa |
100 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32259237 |
ggtttgatattgatctatcaatggaggagaccttacgaggcaacggaaatgtctcactttcatttaattcccagggggtgttgaaaatttgtgtaaaaaa |
32259336 |
T |
 |
Q |
101 |
tgatagaaatgttggctcttatggcattttttctggagataatccatttgatttcactcttccggcaacattgttccaaatcatcgttattgtcgtcctc |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
32259337 |
tgatagaaatgttggctcttatggcattttttctggagataatccattcgatttcactcttccggcaacattgttccaaatcatcattattgtcgtcctc |
32259436 |
T |
 |
Q |
201 |
tctcaaactctttactttcttctcaggccattacgaacaccaaa |
244 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32259437 |
tctcaaactctttactttcttctcaggccattacgaacaccaaa |
32259480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University