View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10110_1D_high_9 (Length: 311)

Name: NF10110_1D_high_9
Description: NF10110_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10110_1D_high_9
NF10110_1D_high_9
[»] chr5 (1 HSPs)
chr5 (3-311)||(39184810-39185120)
[»] chr1 (3 HSPs)
chr1 (232-303)||(42373538-42373609)
chr1 (228-292)||(19597952-19598016)
chr1 (230-298)||(41919898-41919966)
[»] chr2 (1 HSPs)
chr2 (223-298)||(31902961-31903036)
[»] chr8 (4 HSPs)
chr8 (230-292)||(34866640-34866702)
chr8 (225-298)||(9519052-9519125)
chr8 (238-298)||(10551752-10551812)
chr8 (230-298)||(34389590-34389658)
[»] chr7 (3 HSPs)
chr7 (230-292)||(38484991-38485053)
chr7 (223-292)||(3420242-3420311)
chr7 (230-298)||(38305676-38305744)
[»] chr4 (2 HSPs)
chr4 (224-292)||(16501182-16501250)
chr4 (230-298)||(30963879-30963947)
[»] chr6 (1 HSPs)
chr6 (230-272)||(12793553-12793595)
[»] chr3 (1 HSPs)
chr3 (228-298)||(17501810-17501880)


Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 3 - 311
Target Start/End: Complemental strand, 39185120 - 39184810
Alignment:
3 cacggtgggtagtggtgctggttgcttggttttttg---gcggttttgggtatatatcgacnnnnnnnctctgggtgtctcacatgctttcaggtttggt 99  Q
    |||||||||||||||||||||||||||||||||||    | |||||| |||||||||||||       ||||||||||||||| |||||||| ||| |||    
39185120 cacggtgggtagtggtgctggttgcttggttttttttttgtggttttaggtatatatcgactttttt-ctctgggtgtctcacgtgctttcacgttcggt 39185022  T
100 actggttttggtgattttgttgctgagatcggcttcgattgggtcagttccgcaggttaatggggttggttgtttactccggcgacatacgttttctcca 199  Q
    |||||||||||||||||||||||||||||| ||||| ||| ||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||    
39185021 actggttttggtgattttgttgctgagatcagcttccattcggtcagttccgcaggttcatggggttggttgtttactccggcgacatatgttttctcca 39184922  T
200 tgtcaccggcagctgcatttctctgatttaggttgtgattccgcttcaaactggcgtcgttgcccatgttttgtagttgtgtttcgtcttcctatagata 299  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||    
39184921 tgtcaccggcagctgcatttctctgatttaggttgtgattctgcttcaaactggcgtcgttgcctatgttttgtagttgtgtttcgtcttcctatatata 39184822  T
300 tgttttgtgttg 311  Q
    ||||||||||||    
39184821 tgttttgtgttg 39184810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 232 - 303
Target Start/End: Original strand, 42373538 - 42373609
Alignment:
232 ttgtgattccgcttcaaactggcgtcgttgcccatgttttgtagttgtgtttcgtcttcctatagatatgtt 303  Q
    ||||||||||||||||||| || |||||||||| ||||||| ||||||||||||||||||||| ||| ||||    
42373538 ttgtgattccgcttcaaaccggtgtcgttgcccgtgttttgaagttgtgtttcgtcttcctatcgatctgtt 42373609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 292
Target Start/End: Original strand, 19597952 - 19598016
Alignment:
228 taggttgtgattccgcttcaaactggcgtcgttgcccatgttttgtagttgtgtttcgtcttcct 292  Q
    ||||||||| |||| ||||| || ||||||||||||| |||| ||| |||| ||||| |||||||    
19597952 taggttgtgtttccacttcagaccggcgtcgttgcccgtgttctgttgttgggtttcatcttcct 19598016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 230 - 298
Target Start/End: Original strand, 41919898 - 41919966
Alignment:
230 ggttgtgattccgcttcaaactggcgtcgttgcccatgttttgtagttgtgtttcgtcttcctatagat 298  Q
    ||||||| |||||||||||||  |||||||||||| |||||||| || |  |||| ||||||| |||||    
41919898 ggttgtggttccgcttcaaaccagcgtcgttgcccgtgttttgttgtgggatttcatcttcctctagat 41919966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 223 - 298
Target Start/End: Complemental strand, 31903036 - 31902961
Alignment:
223 tgatttaggttgtgattccgcttcaaactggcgtcgttgcccatgttttgtagttgtgtttcgtcttcctatagat 298  Q
    |||| ||||||||| ||||||||||||| ||||||| ||||| |||||||| |||| ||||||||||||| |||||    
31903036 tgatctaggttgtgtttccgcttcaaaccggcgtcgctgcccgtgttttgttgttgggtttcgtcttcctctagat 31902961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 230 - 292
Target Start/End: Complemental strand, 34866702 - 34866640
Alignment:
230 ggttgtgattccgcttcaaactggcgtcgttgcccatgttttgtagttgtgtttcgtcttcct 292  Q
    ||||||| ||||||||||||| ||||||| ||||| |||||||| ||||  ||||||||||||    
34866702 ggttgtggttccgcttcaaaccggcgtcgctgcccgtgttttgttgttggatttcgtcttcct 34866640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 298
Target Start/End: Original strand, 9519052 - 9519125
Alignment:
225 atttaggttgtgattccgcttcaaactggcgtcgttgcccatgttttgtagttgtgtttcgtcttcctatagat 298  Q
    |||| ||||||| | |||||||||||  |||||| ||||| |||||||| |||| |||||||||| || |||||    
9519052 atttgggttgtgttcccgcttcaaaccagcgtcgctgcccgtgttttgttgttgggtttcgtctttctctagat 9519125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 238 - 298
Target Start/End: Original strand, 10551752 - 10551812
Alignment:
238 ttccgcttcaaactggcgtcgttgcccatgttttgtagttgtgtttcgtcttcctatagat 298  Q
    ||||||||||||  ||||||| ||||| || ||||| |||| ||||||||||||| |||||    
10551752 ttccgcttcaaatcggcgtcgctgcccgtgctttgttgttgggtttcgtcttcctctagat 10551812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 230 - 298
Target Start/End: Complemental strand, 34389658 - 34389590
Alignment:
230 ggttgtgattccgcttcaaactggcgtcgttgcccatgttttgtagttgtgtttcgtcttcctatagat 298  Q
    ||||||| ||||||||||||| ||||||| ||||| |||||||| || |  ||||||| |||| |||||    
34389658 ggttgtgcttccgcttcaaaccggcgtcgctgcccgtgttttgttgtggaatttcgtcctcctctagat 34389590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 230 - 292
Target Start/End: Original strand, 38484991 - 38485053
Alignment:
230 ggttgtgattccgcttcaaactggcgtcgttgcccatgttttgtagttgtgtttcgtcttcct 292  Q
    ||||||| ||||||||||||| ||||||| |||||||||||||| ||   |||||||||||||    
38484991 ggttgtgtttccgcttcaaaccggcgtcgctgcccatgttttgttgtcaggtttcgtcttcct 38485053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 292
Target Start/End: Complemental strand, 3420311 - 3420242
Alignment:
223 tgatttaggttgtgattccgcttcaaactggcgtcgttgcccatgttttgtagttgtgtttcgtcttcct 292  Q
    |||| ||||||||| ||||||||| ||| ||||||| ||| | |||||||| |||  |||||||||||||    
3420311 tgatctaggttgtggttccgcttcgaaccggcgtcgctgctcgtgttttgttgtttggtttcgtcttcct 3420242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 230 - 298
Target Start/End: Original strand, 38305676 - 38305744
Alignment:
230 ggttgtgattccgcttcaaactggcgtcgttgcccatgttttgtagttgtgtttcgtcttcctatagat 298  Q
    ||||||| ||||||||||||| ||||| | ||||  |||||||| ||||  |||||||||||| |||||    
38305676 ggttgtggttccgcttcaaaccggcgttgctgcctgtgttttgttgttggatttcgtcttcctctagat 38305744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 224 - 292
Target Start/End: Original strand, 16501182 - 16501250
Alignment:
224 gatttaggttgtgattccgcttcaaactggcgtcgttgcccatgttttgtagttgtgtttcgtcttcct 292  Q
    ||||| |||||||||||| |||||||| ||||||| |||||||||| ||| ||||  ||| ||||||||    
16501182 gatttgggttgtgattccacttcaaaccggcgtcgctgcccatgttgtgttgttggttttagtcttcct 16501250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 230 - 298
Target Start/End: Original strand, 30963879 - 30963947
Alignment:
230 ggttgtgattccgcttcaaactggcgtcgttgcccatgttttgtagttgtgtttcgtcttcctatagat 298  Q
    ||||||| |||| |||||||| ||||||| ||||| |||||||| ||||  |||||||||||| |||||    
30963879 ggttgtggttccacttcaaaccggcgtcgatgcccgtgttttgtggttggatttcgtcttcctctagat 30963947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 230 - 272
Target Start/End: Original strand, 12793553 - 12793595
Alignment:
230 ggttgtgattccgcttcaaactggcgtcgttgcccatgttttg 272  Q
    ||||||| || |||||||||||||||||||||||| |||||||    
12793553 ggttgtgttttcgcttcaaactggcgtcgttgcccgtgttttg 12793595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 228 - 298
Target Start/End: Complemental strand, 17501880 - 17501810
Alignment:
228 taggttgtgattccgcttcaaactggcgtcgttgcccatgttttgtagttgtgtttcgtcttcctatagat 298  Q
    ||||||||| ||||||||||||||| |||| ||| || |||||||| |||   |||||||||||| |||||    
17501880 taggttgtgtttccgcttcaaactgacgtcattgtccgtgttttgttgttagatttcgtcttcctctagat 17501810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University