View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_1D_low_10 (Length: 314)
Name: NF10110_1D_low_10
Description: NF10110_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10110_1D_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 9 - 141
Target Start/End: Original strand, 1041897 - 1042029
Alignment:
| Q |
9 |
gaaatgaataacatagcaaaatagatcaaaactgaaagcaaatttaaatgagattgatgtgcggttatgttgagaagagagatgtgaaacattgagagat |
108 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1041897 |
gaaatgaataagatagcaaaatagatcaaaactgaaagcaaatttaaatgagattgatgtgcggttatgttgagaagagagatgtgaaacattgagagat |
1041996 |
T |
 |
| Q |
109 |
caaatgcaaaaatcttatgtggttggattgtcg |
141 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
1041997 |
caaatgcaaaaatcttatgtggttggtttgtcg |
1042029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 191 - 308
Target Start/End: Original strand, 1042079 - 1042196
Alignment:
| Q |
191 |
cacaagatgggtgtcatgaccgtgataccaagttatgaaatatggcatcgatggattaacaggttataaaatagaacatgtagtagaaatgagaaaggtt |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1042079 |
cacaagatgggtgtcatgaccgtgataccaagttatgaaatatggcatcgatggattaacaggttataaaatagaacatgtagtagaaatgagaaaggtt |
1042178 |
T |
 |
| Q |
291 |
atctttgaatgattaatc |
308 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
1042179 |
atctttgaatgattaatc |
1042196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University