View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_1D_low_16 (Length: 283)
Name: NF10110_1D_low_16
Description: NF10110_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10110_1D_low_16 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 25 - 283
Target Start/End: Complemental strand, 44799090 - 44798832
Alignment:
Q |
25 |
agcaataattggtgttggaggtctagttgaagagtaactaacccaaacacgaaccattttcatatcatctctatactcaatccatgcattgatgattttc |
124 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44799090 |
agcaataattggtgttggaggtctagttgaagagtaactaacccaaacacgaaccattttcatatcatctctatactcaatccatgcattgatgattttc |
44798991 |
T |
 |
Q |
125 |
ccacttttcaaatcaatccgacgtgaaagaagatcagcagaagcaaaagaaacaacactgccaagatcaataccaacgtggtttccattaatgtcaccaa |
224 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44798990 |
ccacttttcaaatcaatccgacgtgaaagaagatcagcagaagcaaaagaaacaacactgccaagatcaataccaacgtggtttccattaatgtcaccaa |
44798891 |
T |
 |
Q |
225 |
gagaaggatcaaaacttgtatcaaattcaaccgcaaagtaagaatcttgatcagaatga |
283 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44798890 |
gagaaggatcaaaactcgtatcaaattcaaccgcaaagtaagaatcttgatcagaatga |
44798832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University