View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_1D_low_20 (Length: 256)
Name: NF10110_1D_low_20
Description: NF10110_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10110_1D_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 39185319 - 39185439
Alignment:
Q |
122 |
agcaatagcagcaagtctcagagacccaacagaacgatataaaccccaatcctaagagtcccaaactcgaattcgaagatacaacaacgaatctgaaaca |
221 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
39185319 |
agcaatagcagcaagtctcagagacccaacagaacgatagaaaccccaatcctaagagacccaaactcgaattcaaagatacaacaacgaatctgaaaca |
39185418 |
T |
 |
Q |
222 |
aaaacacaaaccacaggttct |
242 |
Q |
|
|
|||||||||| |||||||||| |
|
|
T |
39185419 |
aaaacacaaaacacaggttct |
39185439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University