View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_1D_low_21 (Length: 255)
Name: NF10110_1D_low_21
Description: NF10110_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10110_1D_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 12 - 251
Target Start/End: Complemental strand, 37627221 - 37626982
Alignment:
| Q |
12 |
gaacaagatcctctaatgtaccataattgtcaaagatgtcatcaataacatccaaaatgcaaatggtttttgtaagttcaatacgacaatttgaataaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37627221 |
gaacaagatcctctaatgtaccataattgtcaaagatgtcatcaataacatccaaaatgcaaatggtttttgtaagttcaatacgacaatttgaataaca |
37627122 |
T |
 |
| Q |
112 |
tggttctggaaatatccccactgtccataagaaacactctgttggcctatctcttgcaaaacttagtctttcaataagtcccaactctttcgaccaccta |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37627121 |
tggttctggaaatatccccactgtccataagaaacactctgttggtctatctcttgcaaaacttagtctttcaataagtcccaactctttcgaccaccta |
37627022 |
T |
 |
| Q |
212 |
aacaaaatccaataaattagttacaaaatgtagcatttct |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37627021 |
aacaaaatccaataaattagttacaaaatgtagcatttct |
37626982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 12 - 251
Target Start/End: Complemental strand, 37618807 - 37618569
Alignment:
| Q |
12 |
gaacaagatcctctaatgtaccataattgtcaaagatgtcatcaataacatccaaaatgcaaatggtttttgtaagttcaatacgacaatttgaataaca |
111 |
Q |
| |
|
||||||| || |||||||| |||||| |||||||||| ||||| || || |||||| || ||||||||||||||||| || || |||||||||| ||| |
|
|
| T |
37618807 |
gaacaagttcatctaatgttccataagtgtcaaagatatcatccattactagcaaaatacatatggtttttgtaagttctatgcggcaatttgaatgaca |
37618708 |
T |
 |
| Q |
112 |
tggttctggaaatatccccactgtccataagaaacactctgttggcctatctcttgcaaaacttagtctttcaataagtcccaactctttcgaccaccta |
211 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||| |||||||||||||||| ||| |||||| |||||||||||||||| |||||||| |
|
|
| T |
37618707 |
tggttctggaaatatccctactgtccataagaagcactctgttggtctatctcttgcaaaaccaagtttttcaacaagtcccaactctttccaccaccta |
37618608 |
T |
 |
| Q |
212 |
aacaaaatccaataaattagttacaaaatgtagcatttct |
251 |
Q |
| |
|
||| ||||| |||||| |||||| ||||||||||||||| |
|
|
| T |
37618607 |
aac-aaatcaaataaactagttatgaaatgtagcatttct |
37618569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University