View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_1D_low_29 (Length: 221)
Name: NF10110_1D_low_29
Description: NF10110_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10110_1D_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 21 - 214
Target Start/End: Original strand, 52988331 - 52988524
Alignment:
| Q |
21 |
agaaccaagtgaagtgtgatcatgagtatccatgttgatatttttgttatggcagtgttttgtcccgtgggacttatgtccctggcaattgccatgactg |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52988331 |
agaaccaagtgaagtgtgatcatgagtatccatgttgatatttttgtaatggcagtgttttgtcccgtgggacttatgtccctggcaattgccatgactg |
52988430 |
T |
|
| Q |
121 |
ttcaccgcatctgcaccaatatcttctgcatttagattcaaatcatgaaaatctgaacaacacttgttttcaatattatgcttctgaactccat |
214 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
52988431 |
ttcaccgcatctgctccaatatcttctgcatttagattcaaatcatgaaaatctgaacaaaacttgttttcaatattatgcttctggactccat |
52988524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University