View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_1D_low_33 (Length: 211)
Name: NF10110_1D_low_33
Description: NF10110_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10110_1D_low_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 10 - 206
Target Start/End: Complemental strand, 32261499 - 32261303
Alignment:
| Q |
10 |
atgaatcacaaagacacataagggactttcttgaattgggttgcaaatttccactagggcagtcatgccacgaacgtttccttcactatgtaaacaagta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32261499 |
atgaatcacaaagacacataagggactttcttgaattgggttgcaaatttccactagggcagtcatgccacgaacgtttccttcactatgtaaacaagta |
32261400 |
T |
|
| Q |
110 |
acaatgcgaaactctgaatttcttggagtgttttggattgttctcatttcttcatcaaatatgcttgatgaacttaagactcgaggacgatgcttgt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32261399 |
acaatgcgaaactctgaatttcttggagtgttttggattgttctcatttcttcatcaaatatgcttgatgaacttaatactcgaggacgatgcttgt |
32261303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University