View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_2D_high_19 (Length: 283)
Name: NF10110_2D_high_19
Description: NF10110_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10110_2D_high_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 17 - 143
Target Start/End: Complemental strand, 26493061 - 26492935
Alignment:
Q |
17 |
aagtaacatgtgaagctcctgtatataagtaagcttatcatctgtgtgaattgtgtctgactcatatgtttaagattaataaattcatgagtcttacaca |
116 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26493061 |
aagtaacatgtgaagctcctgtatataagtaagcttatcatctgtgtgaattgtgtctgactcatatgtttaagattaataaattcatgagtcttacaca |
26492962 |
T |
 |
Q |
117 |
gataagtgttctttcactttcttatct |
143 |
Q |
|
|
||||||||||||||||||||||||||| |
|
|
T |
26492961 |
gataagtgttctttcactttcttatct |
26492935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 141 - 265
Target Start/End: Original strand, 26493194 - 26493318
Alignment:
Q |
141 |
tcttcacaatttcatattgtttggactatcagcttaatttactgtttataacataagtgcttataagtgcttatgtctaagttttcttggagagcttatg |
240 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26493194 |
tcttcacaatttcatattgtttggactaacagcttaatttactgtttataacataagtgcttataagtgcttatgtctaagttttcttggagagcttatg |
26493293 |
T |
 |
Q |
241 |
gaagtaagctcataacaactgatgg |
265 |
Q |
|
|
|||||||||||| |||||||||||| |
|
|
T |
26493294 |
gaagtaagctcaaaacaactgatgg |
26493318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 218 - 260
Target Start/End: Original strand, 30918128 - 30918170
Alignment:
Q |
218 |
taagttttcttggagagcttatggaagtaagctcataacaact |
260 |
Q |
|
|
|||||||||||||||||||||||||| |||||| | ||||||| |
|
|
T |
30918128 |
taagttttcttggagagcttatggaaataagctgaaaacaact |
30918170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 218 - 250
Target Start/End: Complemental strand, 1125821 - 1125789
Alignment:
Q |
218 |
taagttttcttggagagcttatggaagtaagct |
250 |
Q |
|
|
|||||| |||||||||||||||||||||||||| |
|
|
T |
1125821 |
taagttatcttggagagcttatggaagtaagct |
1125789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University