View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_2D_high_23 (Length: 275)
Name: NF10110_2D_high_23
Description: NF10110_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10110_2D_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 15 - 254
Target Start/End: Original strand, 54416699 - 54416939
Alignment:
| Q |
15 |
tttggtgttagcagaacgtttgcttttctctgatccttttgatgaaaaatttcctgacatgcacgaatgtatgttcatcatgtaagttctttactaatgc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54416699 |
tttggtgttagcagaacgtttgcttttctctgatccttttgatgaaaaatttcctgacatgcacgaatgtatgttcatcatgtaagttctttactaatgc |
54416798 |
T |
 |
| Q |
115 |
accttactatgatctccaaatttaaatatcacaatgagtagctcaatttagaggtattgttccaaagagtagag-ttttgaaagcaatccgtcttacttt |
213 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
54416799 |
accttactatgatctccaaatttaattatcacaatgagtagctcaatttagaggtattgttccaaagagtagagtttttgaaagcaatccgtcttacttt |
54416898 |
T |
 |
| Q |
214 |
tatttgtgggaaccaggatccagcttattgagtttttggtg |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54416899 |
tatttgtgggaaccaggatccagcttattgagtttttggtg |
54416939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University