View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_2D_high_25 (Length: 262)
Name: NF10110_2D_high_25
Description: NF10110_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10110_2D_high_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 22 - 248
Target Start/End: Original strand, 3046186 - 3046402
Alignment:
Q |
22 |
tccaaccccattacatagaagacattacatcaatcatacctagtggaaagacacacgtctttctccgcttccataaattaactacaatcattgagcttcc |
121 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
3046186 |
tccaaccccattacatagaagacattacatcaatcataactagtggaaagacgcacgtctttcttcgcttccataaattaactacaatcattgagcttcc |
3046285 |
T |
 |
Q |
122 |
aaatatggaagacttccttcatccaaccaaatcgagattcattcttcccatcatatattccaagaacatctaactaacggaatgatatcctttctcaaaa |
221 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
T |
3046286 |
aaatatggaagtcttccttcatccaaccaaatcgagattcattcttcccatcatatattcc----------aactaacggaatcatatcctttctcaaaa |
3046375 |
T |
 |
Q |
222 |
tccaccttcactaacaaacaccctttt |
248 |
Q |
|
|
||||||||||||||||||||||||||| |
|
|
T |
3046376 |
tccaccttcactaacaaacaccctttt |
3046402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University