View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_2D_high_33 (Length: 209)
Name: NF10110_2D_high_33
Description: NF10110_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10110_2D_high_33 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 15 - 209
Target Start/End: Original strand, 12778836 - 12779029
Alignment:
Q |
15 |
aatatgaaatatagattaaaatatgaaacaagacttacaatttttcatgtttggctttttgcaggatgttcattttgttgcccaagaagnnnnnnnnctc |
114 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||| ||| |
|
|
T |
12778836 |
aatatgaaatatagattaaaatatgaaacaagacttacaatttttcatgtttgggtttttgcaggatgtccattttgttgcacaagaagaaaaaaa-ctc |
12778934 |
T |
 |
Q |
115 |
atgcaagtccatataatttagttttcgggagcagcattgtggaatcatatatttaatatatcggagtttaactatgtatatattattattactat |
209 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
12778935 |
atgcaagtccatataatttagttttcgggagcagcattgtggaatcatatatataatatatcggagtttaactatgtatatattattataactat |
12779029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University