View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_2D_low_32 (Length: 368)
Name: NF10110_2D_low_32
Description: NF10110_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10110_2D_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 22 - 355
Target Start/End: Original strand, 16454143 - 16454476
Alignment:
| Q |
22 |
aatacttggatgctattgatgaacctgaaaggttgattttttatgaggaaaaaccggtgaaatttgctttatgggttattttttgggcttctatgtcttt |
121 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16454143 |
aatacttagatgctattgatgaacctgaaaggttgattttttatgaggaaaaaccggtgaaatttgctttatgggttattttttgggcttctatgtcttt |
16454242 |
T |
 |
| Q |
122 |
ggcttggtttgcttattcaaaggatgctaatgctgctgctggtactggtgctgttgattctattaaagcttctggatttggattgaagattgcgaattcg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16454243 |
ggcttggtttgcttattcaaaggatgctaatgctgctgctggtactggtgctgttgattctattaaagcttctggatttggattgaagattgcgaattcg |
16454342 |
T |
 |
| Q |
222 |
ttgaggaacttgggtttgcctgattgggttgttgtgtttactcttgctactcttcctattcttgagcttcgtggggctatacctgttggttattggttgc |
321 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16454343 |
ttgaggaaattgggttggcctgattgggttgttgtgtttactcttgctactcttcctgttcttgagcttcgtggggctatacctgttggttattggttgc |
16454442 |
T |
 |
| Q |
322 |
aacttgaccctgcgagtttgactgtgatgtccat |
355 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
16454443 |
aacttgaccctgcgagtttgactgtgttgtccat |
16454476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University