View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_2D_low_40 (Length: 304)
Name: NF10110_2D_low_40
Description: NF10110_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10110_2D_low_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 18 - 296
Target Start/End: Complemental strand, 47253593 - 47253315
Alignment:
| Q |
18 |
aaagtcaaggttttaaactcctcaagctattattgttaacaactgagctacagctagttatttacggttaaactttttcaccgttgcagcaaattcttct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47253593 |
aaagtcaaggttttaaactcctcaagctattattgtcaacaactgagctacagctagttatttacggttaaactttttcaccgttgcagcaaattcttct |
47253494 |
T |
|
| Q |
118 |
ccgagtctgcaaaataattaaccaagattttgacatgtatcactcatgtagggcccttatatgtactagacaacttagtctgtaacagacaagagtaaag |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47253493 |
ccgagtctgcaaaataataaaccaagattttgacatgtatcactcatgtagggcccttatatgtactagataacttagtctgtaacagacaagagtaaag |
47253394 |
T |
|
| Q |
218 |
agctatgaaacaataacttaaatagtaccttctaattcagctattgggatagtgaagcatgtgtttgatttaagagaat |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47253393 |
agctatgaaacaataacttaaatagtaccttctaattcagctattgggatagtgaagcatgtgtttgatttaagagaat |
47253315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University