View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10110_2D_low_46 (Length: 291)

Name: NF10110_2D_low_46
Description: NF10110_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10110_2D_low_46
NF10110_2D_low_46
[»] chr3 (2 HSPs)
chr3 (111-260)||(27741052-27741201)
chr3 (173-260)||(14993801-14993888)
[»] chr4 (2 HSPs)
chr4 (158-260)||(54200631-54200733)
chr4 (151-259)||(19658434-19658542)
[»] chr6 (1 HSPs)
chr6 (147-260)||(22577856-22577969)


Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 111 - 260
Target Start/End: Original strand, 27741052 - 27741201
Alignment:
111 atggcgaaggtggttgttgttttttcaatttgcagcttccaatgggaacactgtgcgtggtgatggttttgtttggtttgtctttgatttgtgatcttga 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||     
27741052 atggcgaaggtggttgttgttttttcaatttgcagcttccaatgggaacactgtgcgtggtgatggttttgtttggtttgtctttgatttgtgatcctgg 27741151  T
211 gttttggtggtttcgtcgctcttcggttgccattcaatggcttctattga 260  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
27741152 gttttggtggtttcgtcgctcttcggttgccattcaatggcttctattga 27741201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 173 - 260
Target Start/End: Complemental strand, 14993888 - 14993801
Alignment:
173 atggttttgtttggtttgtctttgatttgtgatcttgagttttggtggtttcgtcgctcttcggttgccattcaatggcttctattga 260  Q
    ||||||||||| || ||||||||||||||||||  |  ||||| ||||||||||||||||| ||||||| ||||||||||||||||||    
14993888 atggttttgttcgggttgtctttgatttgtgattctaggttttagtggtttcgtcgctctttggttgccgttcaatggcttctattga 14993801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 158 - 260
Target Start/End: Complemental strand, 54200733 - 54200631
Alignment:
158 acactgtgcgtggtgatggttttgtttggtttgtctttgatttgtgatcttgagttttggtggtttcgtcgctcttcggttgccattcaatggcttctat 257  Q
    |||||||| ||||||||||||||||||||||| |||||||||||||||  |||||||| ||||||||||| ||||   |||| | |||| ||||||||||    
54200733 acactgtgtgtggtgatggttttgtttggtttatctttgatttgtgattctgagtttttgtggtttcgtcactctcaagttgtcgttcagtggcttctat 54200634  T
258 tga 260  Q
    |||    
54200633 tga 54200631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 151 - 259
Target Start/End: Complemental strand, 19658542 - 19658434
Alignment:
151 aatgggaacactgtgcgtggtgatggttttgtttggtttgtctttgatttgtgatcttgagttttggtggtttcgtcgctcttcggttgccattcaatgg 250  Q
    ||||| |||| ||||||||||||||| || ||||||||||||||| |||||| ||  || ||||| ||||||||||||||||  |||||   ||||||||    
19658542 aatggaaacagtgtgcgtggtgatggcttcgtttggtttgtcttttatttgtaattctgggttttagtggtttcgtcgctctctggttgtggttcaatgg 19658443  T
251 cttctattg 259  Q
    |||||||||    
19658442 cttctattg 19658434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 147 - 260
Target Start/End: Complemental strand, 22577969 - 22577856
Alignment:
147 ttccaatgggaacactgtgcgtggtgatggttttgtttggtttgtctttgatttgtgatcttgagttttggtggtttcgtcgctcttcggttgccattca 246  Q
    ||||||||| |||| |||||||| | | |||||||||||| ||||||||||||||||||  |  |||||||||||||||||| |||   || ||  ||||    
22577969 ttccaatggcaacattgtgcgtgttcaaggttttgtttgggttgtctttgatttgtgattctaggttttggtggtttcgtcgatctctcgtcgctgttca 22577870  T
247 atggcttctattga 260  Q
    ||||||||||||||    
22577869 atggcttctattga 22577856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University