View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_2D_low_46 (Length: 291)
Name: NF10110_2D_low_46
Description: NF10110_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10110_2D_low_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 111 - 260
Target Start/End: Original strand, 27741052 - 27741201
Alignment:
| Q |
111 |
atggcgaaggtggttgttgttttttcaatttgcagcttccaatgggaacactgtgcgtggtgatggttttgtttggtttgtctttgatttgtgatcttga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
27741052 |
atggcgaaggtggttgttgttttttcaatttgcagcttccaatgggaacactgtgcgtggtgatggttttgtttggtttgtctttgatttgtgatcctgg |
27741151 |
T |
 |
| Q |
211 |
gttttggtggtttcgtcgctcttcggttgccattcaatggcttctattga |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27741152 |
gttttggtggtttcgtcgctcttcggttgccattcaatggcttctattga |
27741201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 173 - 260
Target Start/End: Complemental strand, 14993888 - 14993801
Alignment:
| Q |
173 |
atggttttgtttggtttgtctttgatttgtgatcttgagttttggtggtttcgtcgctcttcggttgccattcaatggcttctattga |
260 |
Q |
| |
|
||||||||||| || |||||||||||||||||| | ||||| ||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
14993888 |
atggttttgttcgggttgtctttgatttgtgattctaggttttagtggtttcgtcgctctttggttgccgttcaatggcttctattga |
14993801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 158 - 260
Target Start/End: Complemental strand, 54200733 - 54200631
Alignment:
| Q |
158 |
acactgtgcgtggtgatggttttgtttggtttgtctttgatttgtgatcttgagttttggtggtttcgtcgctcttcggttgccattcaatggcttctat |
257 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||| |||||||| ||||||||||| |||| |||| | |||| |||||||||| |
|
|
| T |
54200733 |
acactgtgtgtggtgatggttttgtttggtttatctttgatttgtgattctgagtttttgtggtttcgtcactctcaagttgtcgttcagtggcttctat |
54200634 |
T |
 |
| Q |
258 |
tga |
260 |
Q |
| |
|
||| |
|
|
| T |
54200633 |
tga |
54200631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 151 - 259
Target Start/End: Complemental strand, 19658542 - 19658434
Alignment:
| Q |
151 |
aatgggaacactgtgcgtggtgatggttttgtttggtttgtctttgatttgtgatcttgagttttggtggtttcgtcgctcttcggttgccattcaatgg |
250 |
Q |
| |
|
||||| |||| ||||||||||||||| || ||||||||||||||| |||||| || || ||||| |||||||||||||||| ||||| |||||||| |
|
|
| T |
19658542 |
aatggaaacagtgtgcgtggtgatggcttcgtttggtttgtcttttatttgtaattctgggttttagtggtttcgtcgctctctggttgtggttcaatgg |
19658443 |
T |
 |
| Q |
251 |
cttctattg |
259 |
Q |
| |
|
||||||||| |
|
|
| T |
19658442 |
cttctattg |
19658434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 147 - 260
Target Start/End: Complemental strand, 22577969 - 22577856
Alignment:
| Q |
147 |
ttccaatgggaacactgtgcgtggtgatggttttgtttggtttgtctttgatttgtgatcttgagttttggtggtttcgtcgctcttcggttgccattca |
246 |
Q |
| |
|
||||||||| |||| |||||||| | | |||||||||||| |||||||||||||||||| | |||||||||||||||||| ||| || || |||| |
|
|
| T |
22577969 |
ttccaatggcaacattgtgcgtgttcaaggttttgtttgggttgtctttgatttgtgattctaggttttggtggtttcgtcgatctctcgtcgctgttca |
22577870 |
T |
 |
| Q |
247 |
atggcttctattga |
260 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
22577869 |
atggcttctattga |
22577856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University