View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_2D_low_52 (Length: 275)
Name: NF10110_2D_low_52
Description: NF10110_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10110_2D_low_52 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 46632444 - 46632700
Alignment:
| Q |
1 |
ttgagcagggcaggatttcaaatatcgtaggatgcgagttgtgaactgaaaatgcacatgactatgtttagaaacgtgtcgacttagttgctgcacaaca |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46632444 |
ttgagcagggaaggatttcaaatatcgtaggatgcgagttgtgaactgaaaatgcacatgactatgtttagaaacgtgtcgacttggttgctgcacaaca |
46632543 |
T |
|
| Q |
101 |
aaggctatatcaagccttgttgtgtttaaataaataaatctacctattagtctcctatattgagtaatgtcatcaaacagatcagattgcgtgcgatgca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46632544 |
aaggctatatcaagccttgttgtgtttaaataaataagtctacctattagtctcctatattgagtaatgtcatcaaacagagcagattgcgtgcgatgca |
46632643 |
T |
|
| Q |
201 |
attttaaggaagaatcatatggtgtggaagaaggtttggtatccaacatacctgtat |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46632644 |
attttaaggaagaatcatatggtgtggaagagggtttggtatccaacatacctgtat |
46632700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University