View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_2D_low_54 (Length: 275)
Name: NF10110_2D_low_54
Description: NF10110_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10110_2D_low_54 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 7e-95; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 66 - 257
Target Start/End: Original strand, 46632509 - 46632700
Alignment:
Q |
66 |
gtttagaaacgtgtcgacttagttgctgcacaacaaaggctatatcaagccttgttgtgtttaaataaataaatctacctattagtctcctatattgagt |
165 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
46632509 |
gtttagaaacgtgtcgacttggttgctgcacaacaaaggctatatcaagccttgttgtgtttaaataaataagtctacctattagtctcctatattgagt |
46632608 |
T |
 |
Q |
166 |
aatgtcatcaaacagatcagattgcgtgcgatgcaattttaaggaagaatcatatggtgtggaagaaggtttggtatccaacatacctgtat |
257 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
46632609 |
aatgtcatcaaacagagcagattgcgtgcgatgcaattttaaggaagaatcatatggtgtggaagagggtttggtatccaacatacctgtat |
46632700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 46632468 - 46632400
Alignment:
Q |
1 |
atatttgaaatcctgccctgctcaaggcttattttatccttccaattctgatttatgtctttctggttt |
69 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
46632468 |
atatttgaaatccttccctgctcaaggcttattttatccttccaattctgatttatgtctttcttgttt |
46632400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University