View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_2D_low_65 (Length: 232)
Name: NF10110_2D_low_65
Description: NF10110_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10110_2D_low_65 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 11 - 232
Target Start/End: Complemental strand, 8249294 - 8249072
Alignment:
| Q |
11 |
agatggacatcaggtattgaggttaaggggtgacgagaggtgtatgcctgatagagttgttggaatggggg-agaggggactcacgtgccagttaaggag |
109 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||||| |||||||||||||| ||| ||||||||| |
|
|
| T |
8249294 |
agatggagatcaggtattgaggttaaggggtgacgataggtgtatgcctgacagagttgttagaatggggggagaggggactcacgcgcctgttaaggag |
8249195 |
T |
 |
| Q |
110 |
atgggtgagatgccagttggacagggagaaaatgttaaattaggtatgttggaagatggaccgggtgtaggggaagcccattagtcgggtcaaaggtctg |
209 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8249194 |
atgggtgagatgccagttggatagggagaaaatgttaaattaggtatgttggaagatggaccgggtgtaggggaagcccattagtcgggtcaaaggtctg |
8249095 |
T |
 |
| Q |
210 |
ccatccaaatatttctttgaacc |
232 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
8249094 |
ccatccaaatatttctttgaacc |
8249072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University