View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_2D_low_68 (Length: 219)
Name: NF10110_2D_low_68
Description: NF10110_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10110_2D_low_68 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 13 - 119
Target Start/End: Original strand, 363101 - 363207
Alignment:
Q |
13 |
catcagcaatatttggagacatggaggaagatgatccggaataattccgtcggtaatgatggggatcatgatcatgagacttaggcattggattctcctg |
112 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
363101 |
catcagcaatatttggagacatggaggaagatgatccggaataattccgacggtaacgatggggatcatgatcatgagacttaggcattgaattctcctg |
363200 |
T |
 |
Q |
113 |
tactttt |
119 |
Q |
|
|
||||||| |
|
|
T |
363201 |
tactttt |
363207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 112 - 205
Target Start/End: Complemental strand, 364215 - 364122
Alignment:
Q |
112 |
gtacttttggttagttttaattcaagttagttgcaatagttacttacggttagcaatagcaatttatggtttgttataagccatttacggtgta |
205 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
364215 |
gtacttttggttagttttaattcaagttagttgcaatagttacttacggttagcaatagcaatttatggtttgttataagccatttacggtgta |
364122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 60 - 119
Target Start/End: Complemental strand, 41024094 - 41024035
Alignment:
Q |
60 |
cgtcggtaatgatggggatcatgatcatgagacttaggcattggattctcctgtactttt |
119 |
Q |
|
|
||||||||| || ||||| ||||||||||||||| || |||||||||||||| ||||||| |
|
|
T |
41024094 |
cgtcggtaacgaaggggaacatgatcatgagactcagacattggattctcctctactttt |
41024035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University