View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_high_12 (Length: 264)
Name: NF10110_high_12
Description: NF10110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10110_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 6 - 256
Target Start/End: Original strand, 32259210 - 32259460
Alignment:
| Q |
6 |
caaatccaagcaaacatttaattaattggtttgatattgatctatcaatggaggagaccttacgaggcaacggaaatgtctcactttcatttaattccca |
105 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32259210 |
caaatccaagcacacatttaattaattggtttgatattgatctatcaatggaggagaccttacgaggcaacggaaatgtctcactttcatttaattccca |
32259309 |
T |
 |
| Q |
106 |
gggggtgttgaaaatttgtgtaaaaaatgatagaaatgttggctcttatggcattttttctggagataatccatttgatttcactcttccggcaacattg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32259310 |
gggggtgttgaaaatttgtgtaaaaaatgatagaaatgttggctcttatggcattttttctggagataatccattcgatttcactcttccggcaacattg |
32259409 |
T |
 |
| Q |
206 |
ttccaaatcatcgttattgtcgtcctctctcaaactctttactttcttctc |
256 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32259410 |
ttccaaatcatcattattgtcgtcctctctcaaactctttactttcttctc |
32259460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University