View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_high_19 (Length: 225)
Name: NF10110_high_19
Description: NF10110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10110_high_19 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 18098051 - 18097827
Alignment:
| Q |
1 |
gcaaatgtgacacaaacaatgattgcactaacaagctttcatgaactataataatataaatccaattgaaaattatagcacatgattttgtacgaactct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18098051 |
gcaaatgtgacacaaacaatgattgcactaacaagctttcatgaactataataatataaatccaattgaaaattatagcacatgattttgtacgaactct |
18097952 |
T |
 |
| Q |
101 |
atgggggcagctacacacttgtttactcattttaagtcactcacttacaagtgaaaatctttacacttactatgtgatgtaagacaagctatacaatgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18097951 |
atgggggcagctacacacttgtttactcattttaagtcactcacttacaagtgaaaatctttacacttactatgtgatgtaagacaagctatacaatgaa |
18097852 |
T |
 |
| Q |
201 |
ctttattgaggaaatttatcaaaca |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
18097851 |
ctttattgaggaaatttatcaaaca |
18097827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University