View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_high_8 (Length: 298)
Name: NF10110_high_8
Description: NF10110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10110_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 32259037 - 32258756
Alignment:
| Q |
1 |
aaatggaggagacagggatgaaagggttttatatatatacaagaaaaatagaaaggtggaggttaagaatcaataatactaagctatgata--gacacgc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32259037 |
aaatggaggagacagggatgaaagggttttatatatatacaagaaaaatagaaaggtggaggttaagaatcaataatactaagctatgatatagacacgc |
32258938 |
T |
 |
| Q |
99 |
gtttggtatttttgtcaaaaagatttaaattacaacggggacactaaagtattagccactcatacaatagtaggaaatagatatatgatcaaaggtacga |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32258937 |
gtttggtatttttgtcaaaaagatttaaattacaacggggacactaaagtattagccactcatacaatagtaggaaatagatatatgatcaaaggtacga |
32258838 |
T |
 |
| Q |
199 |
ataataggaagctagaagatatacttgtccaaattattcttttttctcaaaattattttaaagaagaaaaaatagttagctt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32258837 |
ataataggaagctagaagatatacttgtccaaattattcttttttctcaaaattattttaaagaagaaaaaatagttagctt |
32258756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University