View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_low_11 (Length: 340)
Name: NF10110_low_11
Description: NF10110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10110_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 2e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 21880001 - 21879771
Alignment:
| Q |
18 |
cttgagaggaaggggtatttattggagcatatttggggaactctcaatgttattattatgggagaaaatttctagttttaatttttnnnnnnntgcacat |
117 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| ||||||| |
|
|
| T |
21880001 |
cttgagaagaaggggtatttattggagcatatttggggaactctcaatgttattattatgggagagaatttatagttttaattttataaaaaatgcacat |
21879902 |
T |
|
| Q |
118 |
catcattcactatataaaggatggatttgcaaatannnnnnnggaaattgatcggtacatgatcagaagagatggctagagaggatgctatggtg----t |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |||| | |
|
|
| T |
21879901 |
catcattcactatataaaggatggatttgcaaata-ttttttggaaattgatcggtacatgatcagaagagatggctagagcggatgctacggtgaaact |
21879803 |
T |
|
| Q |
214 |
ggtggtggttgacaatagttgttgattatcctt |
246 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| |
|
|
| T |
21879802 |
gg-ggtggttgacaatagttgttgattatcctt |
21879771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University