View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_low_14 (Length: 292)
Name: NF10110_low_14
Description: NF10110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10110_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 62 - 286
Target Start/End: Original strand, 18097214 - 18097440
Alignment:
| Q |
62 |
agggaaaataaaaagtacttgttttatattaatattaattaaattaccttctctccnnnnnnnnnnnt--tttaattaaattatcactacaatnnnnnnn |
159 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
18097214 |
agggaaaataaaaagtagttgttttatattaatattgattaaattaccttctctcaaaaaaaaaattaaattaaattaaattatcactacaataaaaaaa |
18097313 |
T |
 |
| Q |
160 |
ncacaatttactgaaacccttttactcctcctctgtcaatgtcatcatctactaatcgtccatggcagtttcatgggtgagaagtagcttcagttcatca |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18097314 |
acacaatttactgaaacccttttactcctcctctgtcaatgtcatcatctactaatcgtccatggcagtttcatgggtgagaagtagcttcagttcatca |
18097413 |
T |
 |
| Q |
260 |
tattcgtttcttagtgatctctgcttc |
286 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
18097414 |
tattcgtttcttagtgatctctgcttc |
18097440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 53
Target Start/End: Original strand, 18097028 - 18097056
Alignment:
| Q |
25 |
gttatatttatttttataaatggatagta |
53 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18097028 |
gttatatttatttttataaatggatagta |
18097056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University