View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_low_15 (Length: 291)
Name: NF10110_low_15
Description: NF10110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10110_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 7 - 268
Target Start/End: Complemental strand, 40471147 - 40470881
Alignment:
Q |
7 |
gaagcataggatttgaggcagaggaagatgactctagaagtaaaagaaggtga--------nnnnnnnnnnnnnnactaaatctatagcctgaagtttat |
98 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
40471147 |
gaagcaaaggatttgaggcagaggaagatgactctagaagtaaaagaaggtgatttttttctttcttttttttttactaaatctatagcctgaagtttat |
40471048 |
T |
 |
Q |
99 |
acataatagcttcatgagtttgcaatatataacttcatattatttgcaatgttttattaaaaactggatcaaaaagacagcttcaactgtgaaccagcca |
198 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40471047 |
acataatagcttcatgagtttgcaatatataacttcatataatttgcaatgtt---ttaaaaactggatcaaaaagacagcttcaactgtgaaccagcca |
40470951 |
T |
 |
Q |
199 |
gttcgttggttggtttcattccagttatgctatagtctggttgaagcagattaaaatagagttgaaccag |
268 |
Q |
|
|
|||||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
40470950 |
gttcgttggttggtttcattccggttatactatagtcaggttgaagcagattaaaatagagttgaaccag |
40470881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University