View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_low_24 (Length: 243)
Name: NF10110_low_24
Description: NF10110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10110_low_24 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 5676564 - 5676803
Alignment:
| Q |
1 |
gttgctatttcagcaagatagttttccattagctttccaacccgttcaatatcactttgtggaggagaaaaatattcatcatcaccattatagacaaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5676564 |
gttgctatttcagcaagatagttttccattagctttccaacccgttcaatatcactttgtggaggagaaaaatattcatcatcaccattatagacaaagt |
5676663 |
T |
 |
| Q |
101 |
gatttccaatttgagattcttggtaattattcatgatcctttgaaccgtgtccacatcgaataacgtgtccccggtaaatgaatatgaaggaatgagaag |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5676664 |
ggtttccaatttgagattcttggtaattattcatgatcctttgaaccgtgtccacatcgaataacgtgtccccggtaaatgaatatgaaggaatgagaag |
5676763 |
T |
 |
| Q |
201 |
atcatccaaaacagcttgtcctaattgcattgccattctt |
240 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5676764 |
atcatccagaacagcttgtcctaattgcattgccattctt |
5676803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 185 - 243
Target Start/End: Complemental strand, 39779078 - 39779020
Alignment:
| Q |
185 |
atgaaggaatgagaagatcatccaaaacagcttgtcctaattgcattgccattcttctc |
243 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||| || || |||||| |
|
|
| T |
39779078 |
atgaaggaaaaagaagatcatccaaaacagcctgtcctaattgcatggctatccttctc |
39779020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University