View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_low_26 (Length: 241)
Name: NF10110_low_26
Description: NF10110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10110_low_26 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 39 - 241
Target Start/End: Complemental strand, 40990102 - 40989899
Alignment:
| Q |
39 |
taaagcttggtgtgcattctgtttctaaaggggtagaatccatattggattcccgagaagtcgtttcaaaagataaaggtatggtttatannnnnnn-cc |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40990102 |
taaagcttggtgtgcattctgtttctaaaggggtagaatccatattggattcccgagaagtcgtttcaaaagataaaggtatggtttatattttttttcc |
40990003 |
T |
 |
| Q |
138 |
cacctcccataaattttgctgttatgtttctcctatacttattgttcatggaatatatactagtaaatttggttattaattataattagtttataacttg |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40990002 |
cacctcccataaattttgctgttatgtttctcctatacttattgttcatggaatatatactagtaagtttggttattaattataattagtttataacttg |
40989903 |
T |
 |
| Q |
238 |
ttgc |
241 |
Q |
| |
|
|||| |
|
|
| T |
40989902 |
ttgc |
40989899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University