View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10110_low_28 (Length: 239)
Name: NF10110_low_28
Description: NF10110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10110_low_28 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 17 - 239
Target Start/End: Original strand, 5676165 - 5676387
Alignment:
| Q |
17 |
atctatttccatacagagataggatgtagaattagatgattgtgagataattcatattctaagtagtagttttaaaacggatttggtgaaatcaaaatac |
116 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5676165 |
atctatttccatagagagataggatgtagaattagatgattgtgagataattcatattctaagtagtagttttaaaacggatttggtgaaatcaaaatat |
5676264 |
T |
|
| Q |
117 |
gagtcatccaattttcatccgactgagatctgtgtagcttttggaaagtcatggtagggtcatcttggttccaacatactcaccgtgataccaacacaag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5676265 |
gagtcatccaattttcatccgactgagatctgtgtagcttttggaaagtcatggtagggtcatcttggttccaacatactcaccgtgataccaacacaag |
5676364 |
T |
|
| Q |
217 |
cgaaatctagctctagaaatgac |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5676365 |
cgaaatctagctctagaaatgac |
5676387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University