View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10111_high_6 (Length: 286)
Name: NF10111_high_6
Description: NF10111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10111_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 52 - 274
Target Start/End: Complemental strand, 16081434 - 16081217
Alignment:
| Q |
52 |
aacatagaaatgcaaacacatttactcattacataaataaattggctttacttaatcatgacagaaattggaagaagaaaactccaaattgtatttcaaa |
151 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16081434 |
aacatagaaatgcaaacacagttactcattacataaataaattggctttacttaatgatgacagaaattggaaggagaaaactccaaattgtatttcaaa |
16081335 |
T |
|
| Q |
152 |
cattgttgtacaagattggttaccgttttaag-ttgaatggaaagcaaaagcagtctcttgcaagagattaacaaactaactacaatactcaaagctaac |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16081334 |
cattgttgtacaagattggttaccgttttaagtttgaatgg------aaagcagtctcttgcaagagattaacaaactaactacaatactcaaagctaac |
16081241 |
T |
|
| Q |
251 |
aaacttctaacacacttcaaccta |
274 |
Q |
| |
|
|||||||||| ||||||||||||| |
|
|
| T |
16081240 |
aaacttctaaaacacttcaaccta |
16081217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University