View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10111_low_28 (Length: 275)
Name: NF10111_low_28
Description: NF10111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10111_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 113 - 248
Target Start/End: Original strand, 8176040 - 8176176
Alignment:
Q |
113 |
gtcaaaacccaccggaaggtcgcaaaaagtctcacgggaagctttattcaacggtagcacaaggaagtatttatcttttaacaatggcagaga-ttagag |
211 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
8176040 |
gtcaaaacccaccggtaggtcgcaaaaagtctcacgggaagctttattcaacggtagcacaaggaagtatttatcttttaacaatggcagagagttagag |
8176139 |
T |
 |
Q |
212 |
ttaacttcaaagaaattcttgtcttgccttaaagaca |
248 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
8176140 |
ttaacttcaaagaaattcttgtcttgccttaaagaca |
8176176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 7 - 104
Target Start/End: Original strand, 8174780 - 8174878
Alignment:
Q |
7 |
gcaacaagcaagaacaactcagtttcaataagtctaggcttgttaaccttgatccatcaactttgtaagagtcatccaagccaa-tcatccataattga |
104 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||||||||| |
|
|
T |
8174780 |
gcaacaagcaagaacaactcagtttcaataagtctaggcttgttaaccttgatccatcaactttgcaagagtcatccaagccaatttatccataattga |
8174878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University