View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10111_low_29 (Length: 273)
Name: NF10111_low_29
Description: NF10111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10111_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 49235480 - 49235222
Alignment:
| Q |
1 |
attgaggcagccacttggtgacaatacttatcaaagacattacacactttcttccatctcacatgagagtttccttggtagccaaggacaccaattgcgg |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49235480 |
attgaggcagccacttgatgacaatacttatcaaagacattacacactttcttccatctcacatgagagtttccttggtagccaaggacaccaattgcgg |
49235381 |
T |
|
| Q |
101 |
tggcggcaccgttgccggaaaatagcaaagccaccatcaatgcgtcaaagatagtgatcaatgttccccaaaacactttgctttttcctctatttagcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49235380 |
tggcggcaccgttgccggaaaatagcaaagccaccatcaatgcgtcaaagatagtgatcaatgttccccaaaacactttgctttttcctctatttagcaa |
49235281 |
T |
|
| Q |
201 |
ggtaagtagcatagagatggctccgtgtgtgcatgctattgcatttgccaccagaaagt |
259 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49235280 |
ggtaagtagcatagagatggctccgtatgtgcatgctattgcatttgccaccagaaagt |
49235222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University