View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10111_low_32 (Length: 254)
Name: NF10111_low_32
Description: NF10111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10111_low_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 235
Target Start/End: Original strand, 40626103 - 40626320
Alignment:
| Q |
18 |
acaatcaacctcttccagcttcatccatgagtcgcacctttagcaggaccaatcctttttcagaaagatacaaaatgttttgtgacaacaacacttcttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40626103 |
acaatcaacctcttccagcttcatccatgagtcgcacgtttagcaggaccaatcctttttcagaaagatacaaaatgttttgtgacaacaacacttcttg |
40626202 |
T |
|
| Q |
118 |
tgctctctctcttctgtcatcaccagtaccacaaacacatgatcatcctgaaaatggattgaatcagatggtgaatactcgctcatcttttatgcaaccc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40626203 |
tgctctctctcttctgtcatcaccagtaccacaaacacatgatcatcctgaaaatggattgaatcagatggtgaatactcactcatcttttatgcaaccc |
40626302 |
T |
|
| Q |
218 |
ttaggcttgagtttgcat |
235 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
40626303 |
ttaggcttgagtttgcat |
40626320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University