View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10111_low_35 (Length: 253)
Name: NF10111_low_35
Description: NF10111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10111_low_35 |
 |  |
|
[»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 15 - 253
Target Start/End: Original strand, 6011495 - 6011733
Alignment:
Q |
15 |
ggacatcaaactgacgagacctatgagtcatagttaatgtctttaaactattcaaatttcaagctggaatgaaaccgcagttgaatcacccaaataaccg |
114 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
T |
6011495 |
ggacatcaaactgacgagacctatgagtcatagttaatgtctttaaactattcaaatttcaagctgggatgaaatcgcagttgaatcacccaaataaccg |
6011594 |
T |
 |
Q |
115 |
aaccggaggcaatctcagttcatggtttaactggttgaaccgtccattttttagcacgttcaatttttgaattacaatggttatgactatttaagtaaac |
214 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6011595 |
aaccggaggcaatctcagttcatggtttaactggttgaactgtccatattttagcacgttcaatttttgaattacaatggttatgactatttaagtaaac |
6011694 |
T |
 |
Q |
215 |
tcctgtcatggtgtctctgagttttcctttttcattaac |
253 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
T |
6011695 |
tcctgtcatggtgtctctgagttttcatttttcattaac |
6011733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University