View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10111_low_40 (Length: 250)
Name: NF10111_low_40
Description: NF10111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10111_low_40 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 102 - 239
Target Start/End: Complemental strand, 34382641 - 34382504
Alignment:
| Q |
102 |
caagcaatacatctcaatttgtctatctaagagagctaatttgataaagggaagcaaaatgtaaacatagagagctacacatttatctcctaatccatta |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34382641 |
caagcaatacatctcaatttgtctatctaagagagctaatttgataaagggaagcaaaatgtaaacatagagagctacacatttatctcctaatccatta |
34382542 |
T |
 |
| Q |
202 |
actatctctaacagcttttctcacattttgagtttcat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34382541 |
actatctctaacagcttttctcacattttgagtttcat |
34382504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 149 - 228
Target Start/End: Complemental strand, 34368076 - 34367997
Alignment:
| Q |
149 |
agggaagcaaaatgtaaacatagagagctacacatttatctcctaatccattaactatctctaacagcttttctcacatt |
228 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||| || |||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
34368076 |
agggaagcaaaatgtaaacaaagagagctgcacatttatatcttaatccattaaccatctctaacaggttttctcacatt |
34367997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 34382742 - 34382689
Alignment:
| Q |
1 |
cttaagtactaaaaaatatagttatacccttttcaatgctcaaagagattcgac |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34382742 |
cttaagtactaaaaaatatagttatacccttttcaatgctcaaagagattcgac |
34382689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University