View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10111_low_47 (Length: 247)
Name: NF10111_low_47
Description: NF10111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10111_low_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 20 - 110
Target Start/End: Original strand, 28382710 - 28382800
Alignment:
Q |
20 |
cgcaattgtgtatgttaactaagatctatttaagataagaaaaatgttaactatgtctcaagggcaccaattaaagactttaaattatatc |
110 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
T |
28382710 |
cgcaattgtgtatgttaactaagatctatttaagatatgaaaaatgttaactatgtctctagggcaccagttaaagactttaaattatatc |
28382800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University