View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10111_low_47 (Length: 247)

Name: NF10111_low_47
Description: NF10111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10111_low_47
NF10111_low_47
[»] chr8 (1 HSPs)
chr8 (20-110)||(28382710-28382800)


Alignment Details
Target: chr8 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 20 - 110
Target Start/End: Original strand, 28382710 - 28382800
Alignment:
20 cgcaattgtgtatgttaactaagatctatttaagataagaaaaatgttaactatgtctcaagggcaccaattaaagactttaaattatatc 110  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||||||||||||    
28382710 cgcaattgtgtatgttaactaagatctatttaagatatgaaaaatgttaactatgtctctagggcaccagttaaagactttaaattatatc 28382800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University