View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10111_low_54 (Length: 241)
Name: NF10111_low_54
Description: NF10111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10111_low_54 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 25 - 223
Target Start/End: Complemental strand, 36964874 - 36964676
Alignment:
| Q |
25 |
ttttacatgtgaaaatatttagacatatcaatctgaaaagggattttaacagctataaatttcgagttaaatatatcaccgtggcagggtcataatcagt |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36964874 |
ttttacatgtgaaaatatttagacatatcaatctgaaaagggattttaacagctataaatttcgagttaaatatatcaccg-ggcagggtcataatcagt |
36964776 |
T |
|
| Q |
125 |
aatctcggcaagctctgaccatttaatacgaactttcttcccaat-aatatatctaaagttgctgctttagcaggttcaacttgaacagaatgatcctcc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36964775 |
aatctcggcaagctctgaccatttaatacgaagtttcttcccaatcaatatatctaaagttgctgctttagcaggttcaacttgaacagaatgatcctcc |
36964676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University